ID: 986026091

View in Genome Browser
Species Human (GRCh38)
Location 5:3852812-3852834
Sequence CACATGCAGACCTCACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026090_986026091 11 Left 986026090 5:3852778-3852800 CCTGCTTTCACATGGCTTCACTA No data
Right 986026091 5:3852812-3852834 CACATGCAGACCTCACTGTCAGG No data
986026088_986026091 23 Left 986026088 5:3852766-3852788 CCGTGCGGGTGTCCTGCTTTCAC No data
Right 986026091 5:3852812-3852834 CACATGCAGACCTCACTGTCAGG No data
986026087_986026091 26 Left 986026087 5:3852763-3852785 CCACCGTGCGGGTGTCCTGCTTT No data
Right 986026091 5:3852812-3852834 CACATGCAGACCTCACTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026091 Original CRISPR CACATGCAGACCTCACTGTC AGG Intergenic
No off target data available for this crispr