ID: 986026269

View in Genome Browser
Species Human (GRCh38)
Location 5:3854418-3854440
Sequence GCATTCCTCCCGAGCGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026269_986026276 7 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026276 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
986026269_986026279 12 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026279 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
986026269_986026284 25 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026284 5:3854466-3854488 TGTGGGCCGGCTGCGATAAGGGG No data
986026269_986026272 -6 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026272 5:3854435-3854457 GAATGCTAATCGCCCGGGCCTGG No data
986026269_986026282 23 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026282 5:3854464-3854486 TTTGTGGGCCGGCTGCGATAAGG No data
986026269_986026285 26 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026285 5:3854467-3854489 GTGGGCCGGCTGCGATAAGGGGG No data
986026269_986026277 8 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026277 5:3854449-3854471 CGGGCCTGGCCCGGCTTTGTGGG No data
986026269_986026273 -1 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026273 5:3854440-3854462 CTAATCGCCCGGGCCTGGCCCGG No data
986026269_986026283 24 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026283 5:3854465-3854487 TTGTGGGCCGGCTGCGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026269 Original CRISPR GCATTCCTCCCGAGCGCGCC AGG (reversed) Intergenic
No off target data available for this crispr