ID: 986026272

View in Genome Browser
Species Human (GRCh38)
Location 5:3854435-3854457
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026269_986026272 -6 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026272 5:3854435-3854457 GAATGCTAATCGCCCGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr