ID: 986026275

View in Genome Browser
Species Human (GRCh38)
Location 5:3854448-3854470
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026275_986026285 -4 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026285 5:3854467-3854489 GTGGGCCGGCTGCGATAAGGGGG No data
986026275_986026284 -5 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026284 5:3854466-3854488 TGTGGGCCGGCTGCGATAAGGGG No data
986026275_986026282 -7 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026282 5:3854464-3854486 TTTGTGGGCCGGCTGCGATAAGG No data
986026275_986026289 22 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026289 5:3854493-3854515 GGGCCCAGCCGCTCCCCACCAGG No data
986026275_986026290 23 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026290 5:3854494-3854516 GGCCCAGCCGCTCCCCACCAGGG No data
986026275_986026287 1 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026287 5:3854472-3854494 CCGGCTGCGATAAGGGGGATCGG No data
986026275_986026283 -6 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026283 5:3854465-3854487 TTGTGGGCCGGCTGCGATAAGGG No data
986026275_986026288 2 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026288 5:3854473-3854495 CGGCTGCGATAAGGGGGATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026275 Original CRISPR CCACAAAGCCGGGCCAGGCC CGG (reversed) Intergenic