ID: 986026277

View in Genome Browser
Species Human (GRCh38)
Location 5:3854449-3854471
Sequence CGGGCCTGGCCCGGCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026269_986026277 8 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026277 5:3854449-3854471 CGGGCCTGGCCCGGCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026277 Original CRISPR CGGGCCTGGCCCGGCTTTGT GGG Intergenic
No off target data available for this crispr