ID: 986026278

View in Genome Browser
Species Human (GRCh38)
Location 5:3854453-3854475
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026278_986026289 17 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026289 5:3854493-3854515 GGGCCCAGCCGCTCCCCACCAGG No data
986026278_986026285 -9 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026285 5:3854467-3854489 GTGGGCCGGCTGCGATAAGGGGG No data
986026278_986026284 -10 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026284 5:3854466-3854488 TGTGGGCCGGCTGCGATAAGGGG No data
986026278_986026288 -3 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026288 5:3854473-3854495 CGGCTGCGATAAGGGGGATCGGG No data
986026278_986026290 18 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026290 5:3854494-3854516 GGCCCAGCCGCTCCCCACCAGGG No data
986026278_986026287 -4 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026287 5:3854472-3854494 CCGGCTGCGATAAGGGGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026278 Original CRISPR CCGGCCCACAAAGCCGGGCC AGG (reversed) Intergenic