ID: 986026283

View in Genome Browser
Species Human (GRCh38)
Location 5:3854465-3854487
Sequence TTGTGGGCCGGCTGCGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026274_986026283 -5 Left 986026274 5:3854447-3854469 CCCGGGCCTGGCCCGGCTTTGTG No data
Right 986026283 5:3854465-3854487 TTGTGGGCCGGCTGCGATAAGGG No data
986026269_986026283 24 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026283 5:3854465-3854487 TTGTGGGCCGGCTGCGATAAGGG No data
986026275_986026283 -6 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026283 5:3854465-3854487 TTGTGGGCCGGCTGCGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026283 Original CRISPR TTGTGGGCCGGCTGCGATAA GGG Intergenic
No off target data available for this crispr