ID: 986026284

View in Genome Browser
Species Human (GRCh38)
Location 5:3854466-3854488
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026274_986026284 -4 Left 986026274 5:3854447-3854469 CCCGGGCCTGGCCCGGCTTTGTG No data
Right 986026284 5:3854466-3854488 TGTGGGCCGGCTGCGATAAGGGG No data
986026278_986026284 -10 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026284 5:3854466-3854488 TGTGGGCCGGCTGCGATAAGGGG No data
986026275_986026284 -5 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026284 5:3854466-3854488 TGTGGGCCGGCTGCGATAAGGGG No data
986026269_986026284 25 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026284 5:3854466-3854488 TGTGGGCCGGCTGCGATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type