ID: 986026285

View in Genome Browser
Species Human (GRCh38)
Location 5:3854467-3854489
Sequence GTGGGCCGGCTGCGATAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026275_986026285 -4 Left 986026275 5:3854448-3854470 CCGGGCCTGGCCCGGCTTTGTGG No data
Right 986026285 5:3854467-3854489 GTGGGCCGGCTGCGATAAGGGGG No data
986026278_986026285 -9 Left 986026278 5:3854453-3854475 CCTGGCCCGGCTTTGTGGGCCGG No data
Right 986026285 5:3854467-3854489 GTGGGCCGGCTGCGATAAGGGGG No data
986026269_986026285 26 Left 986026269 5:3854418-3854440 CCTGGCGCGCTCGGGAGGAATGC No data
Right 986026285 5:3854467-3854489 GTGGGCCGGCTGCGATAAGGGGG No data
986026274_986026285 -3 Left 986026274 5:3854447-3854469 CCCGGGCCTGGCCCGGCTTTGTG No data
Right 986026285 5:3854467-3854489 GTGGGCCGGCTGCGATAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026285 Original CRISPR GTGGGCCGGCTGCGATAAGG GGG Intergenic
No off target data available for this crispr