ID: 986028551

View in Genome Browser
Species Human (GRCh38)
Location 5:3873614-3873636
Sequence AATGGTTGCCAGCAATTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986028546_986028551 29 Left 986028546 5:3873562-3873584 CCAACTATAGGACATTTGGTAAA No data
Right 986028551 5:3873614-3873636 AATGGTTGCCAGCAATTCAAGGG No data
986028548_986028551 -1 Left 986028548 5:3873592-3873614 CCATGGTGACAGTCAGAAGATGA No data
Right 986028551 5:3873614-3873636 AATGGTTGCCAGCAATTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986028551 Original CRISPR AATGGTTGCCAGCAATTCAA GGG Intergenic
No off target data available for this crispr