ID: 986037630

View in Genome Browser
Species Human (GRCh38)
Location 5:3955495-3955517
Sequence CTCATTCTGCACATTTATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986037628_986037630 -6 Left 986037628 5:3955478-3955500 CCTATGTAACAAACCTGCTCATT 0: 17
1: 2306
2: 7876
3: 11234
4: 9547
Right 986037630 5:3955495-3955517 CTCATTCTGCACATTTATCTCGG No data
986037627_986037630 10 Left 986037627 5:3955462-3955484 CCATGGCACATGTATACCTATGT 0: 2661
1: 5018
2: 5253
3: 4573
4: 3653
Right 986037630 5:3955495-3955517 CTCATTCTGCACATTTATCTCGG No data
986037625_986037630 21 Left 986037625 5:3955451-3955473 CCTATCAACCACCATGGCACATG No data
Right 986037630 5:3955495-3955517 CTCATTCTGCACATTTATCTCGG No data
986037626_986037630 13 Left 986037626 5:3955459-3955481 CCACCATGGCACATGTATACCTA 0: 2643
1: 6365
2: 26338
3: 13070
4: 5674
Right 986037630 5:3955495-3955517 CTCATTCTGCACATTTATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986037630 Original CRISPR CTCATTCTGCACATTTATCT CGG Intergenic
No off target data available for this crispr