ID: 986049983

View in Genome Browser
Species Human (GRCh38)
Location 5:4081101-4081123
Sequence CAGTGCAATTTCTCTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986049983_986049987 19 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049987 5:4081143-4081165 AGAGAATTCTCATAACTGCTGGG No data
986049983_986049988 27 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049988 5:4081151-4081173 CTCATAACTGCTGGGCGTCGAGG No data
986049983_986049986 18 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049986 5:4081142-4081164 GAGAGAATTCTCATAACTGCTGG No data
986049983_986049985 -9 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049985 5:4081115-4081137 ATTGCACTGTAGTTCTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986049983 Original CRISPR CAGTGCAATTTCTCTGATTT GGG (reversed) Intergenic