ID: 986049985

View in Genome Browser
Species Human (GRCh38)
Location 5:4081115-4081137
Sequence ATTGCACTGTAGTTCTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986049984_986049985 -10 Left 986049984 5:4081102-4081124 CCAAATCAGAGAAATTGCACTGT No data
Right 986049985 5:4081115-4081137 ATTGCACTGTAGTTCTGAGAAGG No data
986049983_986049985 -9 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049985 5:4081115-4081137 ATTGCACTGTAGTTCTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986049985 Original CRISPR ATTGCACTGTAGTTCTGAGA AGG Intergenic