ID: 986049986

View in Genome Browser
Species Human (GRCh38)
Location 5:4081142-4081164
Sequence GAGAGAATTCTCATAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986049984_986049986 17 Left 986049984 5:4081102-4081124 CCAAATCAGAGAAATTGCACTGT No data
Right 986049986 5:4081142-4081164 GAGAGAATTCTCATAACTGCTGG No data
986049983_986049986 18 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049986 5:4081142-4081164 GAGAGAATTCTCATAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986049986 Original CRISPR GAGAGAATTCTCATAACTGC TGG Intergenic