ID: 986049987

View in Genome Browser
Species Human (GRCh38)
Location 5:4081143-4081165
Sequence AGAGAATTCTCATAACTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986049983_986049987 19 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049987 5:4081143-4081165 AGAGAATTCTCATAACTGCTGGG No data
986049984_986049987 18 Left 986049984 5:4081102-4081124 CCAAATCAGAGAAATTGCACTGT No data
Right 986049987 5:4081143-4081165 AGAGAATTCTCATAACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986049987 Original CRISPR AGAGAATTCTCATAACTGCT GGG Intergenic