ID: 986049988

View in Genome Browser
Species Human (GRCh38)
Location 5:4081151-4081173
Sequence CTCATAACTGCTGGGCGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986049983_986049988 27 Left 986049983 5:4081101-4081123 CCCAAATCAGAGAAATTGCACTG No data
Right 986049988 5:4081151-4081173 CTCATAACTGCTGGGCGTCGAGG No data
986049984_986049988 26 Left 986049984 5:4081102-4081124 CCAAATCAGAGAAATTGCACTGT No data
Right 986049988 5:4081151-4081173 CTCATAACTGCTGGGCGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986049988 Original CRISPR CTCATAACTGCTGGGCGTCG AGG Intergenic
No off target data available for this crispr