ID: 986057582

View in Genome Browser
Species Human (GRCh38)
Location 5:4154007-4154029
Sequence AGGGGCTCTCTTAGCTCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986057582_986057590 5 Left 986057582 5:4154007-4154029 CCCGGAGAGCTAAGAGAGCCCCT No data
Right 986057590 5:4154035-4154057 CACAGGAGAACACAGTGAGAAGG No data
986057582_986057591 23 Left 986057582 5:4154007-4154029 CCCGGAGAGCTAAGAGAGCCCCT No data
Right 986057591 5:4154053-4154075 GAAGGCACCATCTGTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986057582 Original CRISPR AGGGGCTCTCTTAGCTCTCC GGG (reversed) Intergenic
No off target data available for this crispr