ID: 986060076

View in Genome Browser
Species Human (GRCh38)
Location 5:4179736-4179758
Sequence CACTGAACAAACTCTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986060074_986060076 22 Left 986060074 5:4179691-4179713 CCCTGTTAATGGGAATGTAGACA No data
Right 986060076 5:4179736-4179758 CACTGAACAAACTCTCCCAGTGG No data
986060075_986060076 21 Left 986060075 5:4179692-4179714 CCTGTTAATGGGAATGTAGACAA No data
Right 986060076 5:4179736-4179758 CACTGAACAAACTCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986060076 Original CRISPR CACTGAACAAACTCTCCCAG TGG Intergenic
No off target data available for this crispr