ID: 986061061

View in Genome Browser
Species Human (GRCh38)
Location 5:4191805-4191827
Sequence GTGCAGGGCCTTTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986061056_986061061 -9 Left 986061056 5:4191791-4191813 CCAGACACCACCATGTGCAGGGC No data
Right 986061061 5:4191805-4191827 GTGCAGGGCCTTTCTGAGGAGGG No data
986061053_986061061 22 Left 986061053 5:4191760-4191782 CCTTAAATACTTGACAACTTCAC No data
Right 986061061 5:4191805-4191827 GTGCAGGGCCTTTCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986061061 Original CRISPR GTGCAGGGCCTTTCTGAGGA GGG Intergenic
No off target data available for this crispr