ID: 986064920

View in Genome Browser
Species Human (GRCh38)
Location 5:4225883-4225905
Sequence CTAGGGACACAGAGAGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986064920_986064921 -8 Left 986064920 5:4225883-4225905 CCGTGTTCTCTCTGTGTCCCTAG No data
Right 986064921 5:4225898-4225920 GTCCCTAGCACTTGCTAGCATGG No data
986064920_986064924 -1 Left 986064920 5:4225883-4225905 CCGTGTTCTCTCTGTGTCCCTAG No data
Right 986064924 5:4225905-4225927 GCACTTGCTAGCATGGCTCAAGG No data
986064920_986064925 26 Left 986064920 5:4225883-4225905 CCGTGTTCTCTCTGTGTCCCTAG No data
Right 986064925 5:4225932-4225954 CTTGTTGAATGCACTGCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986064920 Original CRISPR CTAGGGACACAGAGAGAACA CGG (reversed) Intergenic
No off target data available for this crispr