ID: 986073650

View in Genome Browser
Species Human (GRCh38)
Location 5:4312465-4312487
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986073650_986073655 -6 Left 986073650 5:4312465-4312487 CCTTCCTTTCACTGTGCAAACAG No data
Right 986073655 5:4312482-4312504 AAACAGGCTGGGTGCAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986073650 Original CRISPR CTGTTTGCACAGTGAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr