ID: 986077610

View in Genome Browser
Species Human (GRCh38)
Location 5:4354249-4354271
Sequence ACCAAACTGGTGACCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986077610_986077615 3 Left 986077610 5:4354249-4354271 CCCTTCCTGGTCACCAGTTTGGT No data
Right 986077615 5:4354275-4354297 TGGCCCCTCCCCTCCCATCGAGG No data
986077610_986077625 28 Left 986077610 5:4354249-4354271 CCCTTCCTGGTCACCAGTTTGGT No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077610_986077624 24 Left 986077610 5:4354249-4354271 CCCTTCCTGGTCACCAGTTTGGT No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986077610 Original CRISPR ACCAAACTGGTGACCAGGAA GGG (reversed) Intergenic