ID: 986077614

View in Genome Browser
Species Human (GRCh38)
Location 5:4354262-4354284
Sequence GGAGGGGCCAGTCACCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986077614_986077615 -10 Left 986077614 5:4354262-4354284 CCAGTTTGGTGACTGGCCCCTCC No data
Right 986077615 5:4354275-4354297 TGGCCCCTCCCCTCCCATCGAGG No data
986077614_986077625 15 Left 986077614 5:4354262-4354284 CCAGTTTGGTGACTGGCCCCTCC No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077614_986077624 11 Left 986077614 5:4354262-4354284 CCAGTTTGGTGACTGGCCCCTCC No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986077614 Original CRISPR GGAGGGGCCAGTCACCAAAC TGG (reversed) Intergenic
No off target data available for this crispr