ID: 986077616

View in Genome Browser
Species Human (GRCh38)
Location 5:4354278-4354300
Sequence CAGCCTCGATGGGAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986077616_986077625 -1 Left 986077616 5:4354278-4354300 CCCCTCCCCTCCCATCGAGGCTG No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077616_986077628 29 Left 986077616 5:4354278-4354300 CCCCTCCCCTCCCATCGAGGCTG No data
Right 986077628 5:4354330-4354352 GCTACCTCACCTCCCTCTATTGG No data
986077616_986077624 -5 Left 986077616 5:4354278-4354300 CCCCTCCCCTCCCATCGAGGCTG No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986077616 Original CRISPR CAGCCTCGATGGGAGGGGAG GGG (reversed) Intergenic
No off target data available for this crispr