ID: 986077620

View in Genome Browser
Species Human (GRCh38)
Location 5:4354284-4354306
Sequence TTCTGGCAGCCTCGATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986077620_986077628 23 Left 986077620 5:4354284-4354306 CCCTCCCATCGAGGCTGCCAGAA No data
Right 986077628 5:4354330-4354352 GCTACCTCACCTCCCTCTATTGG No data
986077620_986077625 -7 Left 986077620 5:4354284-4354306 CCCTCCCATCGAGGCTGCCAGAA No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986077620 Original CRISPR TTCTGGCAGCCTCGATGGGA GGG (reversed) Intergenic
No off target data available for this crispr