ID: 986077621

View in Genome Browser
Species Human (GRCh38)
Location 5:4354285-4354307
Sequence ATTCTGGCAGCCTCGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986077621_986077630 30 Left 986077621 5:4354285-4354307 CCTCCCATCGAGGCTGCCAGAAT No data
Right 986077630 5:4354338-4354360 ACCTCCCTCTATTGGCTTTTCGG No data
986077621_986077625 -8 Left 986077621 5:4354285-4354307 CCTCCCATCGAGGCTGCCAGAAT No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077621_986077628 22 Left 986077621 5:4354285-4354307 CCTCCCATCGAGGCTGCCAGAAT No data
Right 986077628 5:4354330-4354352 GCTACCTCACCTCCCTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986077621 Original CRISPR ATTCTGGCAGCCTCGATGGG AGG (reversed) Intergenic
No off target data available for this crispr