ID: 986077624

View in Genome Browser
Species Human (GRCh38)
Location 5:4354296-4354318
Sequence GGCTGCCAGAATTCCTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986077619_986077624 -10 Left 986077619 5:4354283-4354305 CCCCTCCCATCGAGGCTGCCAGA No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data
986077610_986077624 24 Left 986077610 5:4354249-4354271 CCCTTCCTGGTCACCAGTTTGGT No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data
986077618_986077624 -7 Left 986077618 5:4354280-4354302 CCTCCCCTCCCATCGAGGCTGCC No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data
986077617_986077624 -6 Left 986077617 5:4354279-4354301 CCCTCCCCTCCCATCGAGGCTGC No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data
986077611_986077624 23 Left 986077611 5:4354250-4354272 CCTTCCTGGTCACCAGTTTGGTG No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data
986077612_986077624 19 Left 986077612 5:4354254-4354276 CCTGGTCACCAGTTTGGTGACTG No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data
986077616_986077624 -5 Left 986077616 5:4354278-4354300 CCCCTCCCCTCCCATCGAGGCTG No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data
986077614_986077624 11 Left 986077614 5:4354262-4354284 CCAGTTTGGTGACTGGCCCCTCC No data
Right 986077624 5:4354296-4354318 GGCTGCCAGAATTCCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986077624 Original CRISPR GGCTGCCAGAATTCCTGCAC TGG Intergenic
No off target data available for this crispr