ID: 986077625

View in Genome Browser
Species Human (GRCh38)
Location 5:4354300-4354322
Sequence GCCAGAATTCCTGCACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986077621_986077625 -8 Left 986077621 5:4354285-4354307 CCTCCCATCGAGGCTGCCAGAAT No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077617_986077625 -2 Left 986077617 5:4354279-4354301 CCCTCCCCTCCCATCGAGGCTGC No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077619_986077625 -6 Left 986077619 5:4354283-4354305 CCCCTCCCATCGAGGCTGCCAGA No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077620_986077625 -7 Left 986077620 5:4354284-4354306 CCCTCCCATCGAGGCTGCCAGAA No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077618_986077625 -3 Left 986077618 5:4354280-4354302 CCTCCCCTCCCATCGAGGCTGCC No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077610_986077625 28 Left 986077610 5:4354249-4354271 CCCTTCCTGGTCACCAGTTTGGT No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077614_986077625 15 Left 986077614 5:4354262-4354284 CCAGTTTGGTGACTGGCCCCTCC No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077616_986077625 -1 Left 986077616 5:4354278-4354300 CCCCTCCCCTCCCATCGAGGCTG No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077611_986077625 27 Left 986077611 5:4354250-4354272 CCTTCCTGGTCACCAGTTTGGTG No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data
986077612_986077625 23 Left 986077612 5:4354254-4354276 CCTGGTCACCAGTTTGGTGACTG No data
Right 986077625 5:4354300-4354322 GCCAGAATTCCTGCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986077625 Original CRISPR GCCAGAATTCCTGCACTGGC TGG Intergenic
No off target data available for this crispr