ID: 986080628

View in Genome Browser
Species Human (GRCh38)
Location 5:4388866-4388888
Sequence TAGCCAAGGCTGCCCTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986080628_986080633 -7 Left 986080628 5:4388866-4388888 CCTGTTCAGGGCAGCCTTGGCTA No data
Right 986080633 5:4388882-4388904 TTGGCTACTGGCCTCAGGTAGGG No data
986080628_986080634 1 Left 986080628 5:4388866-4388888 CCTGTTCAGGGCAGCCTTGGCTA No data
Right 986080634 5:4388890-4388912 TGGCCTCAGGTAGGGCTTCCAGG No data
986080628_986080632 -8 Left 986080628 5:4388866-4388888 CCTGTTCAGGGCAGCCTTGGCTA No data
Right 986080632 5:4388881-4388903 CTTGGCTACTGGCCTCAGGTAGG No data
986080628_986080636 16 Left 986080628 5:4388866-4388888 CCTGTTCAGGGCAGCCTTGGCTA No data
Right 986080636 5:4388905-4388927 CTTCCAGGCTTCTCCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986080628 Original CRISPR TAGCCAAGGCTGCCCTGAAC AGG (reversed) Intergenic
No off target data available for this crispr