ID: 986081102

View in Genome Browser
Species Human (GRCh38)
Location 5:4394991-4395013
Sequence CTAGGGGAGTGGAGTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986081102_986081111 25 Left 986081102 5:4394991-4395013 CCTTCTGCACTCCACTCCCCTAG No data
Right 986081111 5:4395039-4395061 TCCCGCAGCAAACTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986081102 Original CRISPR CTAGGGGAGTGGAGTGCAGA AGG (reversed) Intergenic
No off target data available for this crispr