ID: 986081400

View in Genome Browser
Species Human (GRCh38)
Location 5:4398597-4398619
Sequence CCGGCGTGGTCTCCACGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986081400_986081409 5 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081409 5:4398625-4398647 CTCACAGGCCCCCCAGGGTAGGG No data
986081400_986081411 12 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081411 5:4398632-4398654 GCCCCCCAGGGTAGGGGCCATGG No data
986081400_986081406 0 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081406 5:4398620-4398642 TGTTCCTCACAGGCCCCCCAGGG No data
986081400_986081410 6 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081410 5:4398626-4398648 TCACAGGCCCCCCAGGGTAGGGG No data
986081400_986081408 4 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG No data
986081400_986081402 -10 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081402 5:4398610-4398632 ACCACGCCGGTGTTCCTCACAGG No data
986081400_986081405 -1 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081405 5:4398619-4398641 GTGTTCCTCACAGGCCCCCCAGG No data
986081400_986081415 15 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081415 5:4398635-4398657 CCCCAGGGTAGGGGCCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986081400 Original CRISPR CCGGCGTGGTCTCCACGCCT TGG (reversed) Intergenic
No off target data available for this crispr