ID: 986081403

View in Genome Browser
Species Human (GRCh38)
Location 5:4398611-4398633
Sequence GCCTGTGAGGAACACCGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986081403_986081415 1 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081415 5:4398635-4398657 CCCCAGGGTAGGGGCCATGGTGG No data
986081403_986081411 -2 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081411 5:4398632-4398654 GCCCCCCAGGGTAGGGGCCATGG No data
986081403_986081420 21 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081420 5:4398655-4398677 TGGATGCAGAGCCAGCCGCTGGG No data
986081403_986081409 -9 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081409 5:4398625-4398647 CTCACAGGCCCCCCAGGGTAGGG No data
986081403_986081419 20 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081419 5:4398654-4398676 GTGGATGCAGAGCCAGCCGCTGG No data
986081403_986081410 -8 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081410 5:4398626-4398648 TCACAGGCCCCCCAGGGTAGGGG No data
986081403_986081408 -10 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986081403 Original CRISPR GCCTGTGAGGAACACCGGCG TGG (reversed) Intergenic
No off target data available for this crispr