ID: 986081408

View in Genome Browser
Species Human (GRCh38)
Location 5:4398624-4398646
Sequence CCTCACAGGCCCCCCAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986081400_986081408 4 Left 986081400 5:4398597-4398619 CCAAGGCGTGGAGACCACGCCGG No data
Right 986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG No data
986081399_986081408 5 Left 986081399 5:4398596-4398618 CCCAAGGCGTGGAGACCACGCCG No data
Right 986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG No data
986081397_986081408 20 Left 986081397 5:4398581-4398603 CCGAGAGAAAGACGTCCCAAGGC No data
Right 986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG No data
986081403_986081408 -10 Left 986081403 5:4398611-4398633 CCACGCCGGTGTTCCTCACAGGC No data
Right 986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986081408 Original CRISPR CCTCACAGGCCCCCCAGGGT AGG Intergenic
No off target data available for this crispr