ID: 986082078

View in Genome Browser
Species Human (GRCh38)
Location 5:4405473-4405495
Sequence CAGGGGAAGCTTGAGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986082070_986082078 6 Left 986082070 5:4405444-4405466 CCTCTTTTACATCTGTGGACCAA No data
Right 986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986082078 Original CRISPR CAGGGGAAGCTTGAGTAGGG AGG Intergenic
No off target data available for this crispr