ID: 986082296

View in Genome Browser
Species Human (GRCh38)
Location 5:4407728-4407750
Sequence GCTTCCTTCTGGAGGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986082284_986082296 16 Left 986082284 5:4407689-4407711 CCACATGGGGCTCCCTGGATGTC No data
Right 986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG No data
986082289_986082296 3 Left 986082289 5:4407702-4407724 CCTGGATGTCAGGGGCCTACAGG No data
Right 986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG No data
986082288_986082296 4 Left 986082288 5:4407701-4407723 CCCTGGATGTCAGGGGCCTACAG No data
Right 986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986082296 Original CRISPR GCTTCCTTCTGGAGGCTGTG GGG Intergenic
No off target data available for this crispr