ID: 986082742

View in Genome Browser
Species Human (GRCh38)
Location 5:4411005-4411027
Sequence AGTTCTCTCCTGGAGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986082742_986082748 10 Left 986082742 5:4411005-4411027 CCATGTGCCTCCAGGAGAGAACT No data
Right 986082748 5:4411038-4411060 CCAGATGTTCTTGTCAATTCTGG No data
986082742_986082749 13 Left 986082742 5:4411005-4411027 CCATGTGCCTCCAGGAGAGAACT No data
Right 986082749 5:4411041-4411063 GATGTTCTTGTCAATTCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986082742 Original CRISPR AGTTCTCTCCTGGAGGCACA TGG (reversed) Intergenic
No off target data available for this crispr