ID: 986087107

View in Genome Browser
Species Human (GRCh38)
Location 5:4462688-4462710
Sequence ATTTATCTGCAGAAGATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986087107_986087112 25 Left 986087107 5:4462688-4462710 CCTGCTATCTTCTGCAGATAAAT No data
Right 986087112 5:4462736-4462758 GGCCTGTTAGTGGGCTTTAGTGG No data
986087107_986087108 4 Left 986087107 5:4462688-4462710 CCTGCTATCTTCTGCAGATAAAT No data
Right 986087108 5:4462715-4462737 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
986087107_986087110 15 Left 986087107 5:4462688-4462710 CCTGCTATCTTCTGCAGATAAAT No data
Right 986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG No data
986087107_986087111 16 Left 986087107 5:4462688-4462710 CCTGCTATCTTCTGCAGATAAAT No data
Right 986087111 5:4462727-4462749 ACAGCTCTTGGCCTGTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986087107 Original CRISPR ATTTATCTGCAGAAGATAGC AGG (reversed) Intergenic
No off target data available for this crispr