ID: 986087110

View in Genome Browser
Species Human (GRCh38)
Location 5:4462726-4462748
Sequence GACAGCTCTTGGCCTGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986087106_986087110 16 Left 986087106 5:4462687-4462709 CCCTGCTATCTTCTGCAGATAAA No data
Right 986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG No data
986087107_986087110 15 Left 986087107 5:4462688-4462710 CCTGCTATCTTCTGCAGATAAAT No data
Right 986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986087110 Original CRISPR GACAGCTCTTGGCCTGTTAG TGG Intergenic
No off target data available for this crispr