ID: 986087751

View in Genome Browser
Species Human (GRCh38)
Location 5:4468612-4468634
Sequence CTGACTCAGCAGGAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986087751_986087757 21 Left 986087751 5:4468612-4468634 CCTCTCTCCTCCTGCTGAGTCAG No data
Right 986087757 5:4468656-4468678 ACTTGCTGCATCCTCTGTCGAGG No data
986087751_986087754 -10 Left 986087751 5:4468612-4468634 CCTCTCTCCTCCTGCTGAGTCAG No data
Right 986087754 5:4468625-4468647 GCTGAGTCAGCTCTCACCTCTGG No data
986087751_986087755 -9 Left 986087751 5:4468612-4468634 CCTCTCTCCTCCTGCTGAGTCAG No data
Right 986087755 5:4468626-4468648 CTGAGTCAGCTCTCACCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986087751 Original CRISPR CTGACTCAGCAGGAGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr