ID: 986089791

View in Genome Browser
Species Human (GRCh38)
Location 5:4493081-4493103
Sequence GCACTCACTTCAGCAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986089791_986089799 18 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG No data
986089791_986089798 17 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089798 5:4493121-4493143 AGTGGACACAGGCAGGCCTCTGG No data
986089791_986089793 -1 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089793 5:4493103-4493125 CTTCAGACGCCACCATGCAGTGG No data
986089791_986089796 10 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089796 5:4493114-4493136 ACCATGCAGTGGACACAGGCAGG No data
986089791_986089794 6 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089794 5:4493110-4493132 CGCCACCATGCAGTGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986089791 Original CRISPR GCACTCACTTCAGCAAAGCT GGG (reversed) Intergenic
No off target data available for this crispr