ID: 986089792

View in Genome Browser
Species Human (GRCh38)
Location 5:4493082-4493104
Sequence AGCACTCACTTCAGCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986089792_986089796 9 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089796 5:4493114-4493136 ACCATGCAGTGGACACAGGCAGG No data
986089792_986089793 -2 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089793 5:4493103-4493125 CTTCAGACGCCACCATGCAGTGG No data
986089792_986089794 5 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089794 5:4493110-4493132 CGCCACCATGCAGTGGACACAGG No data
986089792_986089799 17 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG No data
986089792_986089798 16 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089798 5:4493121-4493143 AGTGGACACAGGCAGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986089792 Original CRISPR AGCACTCACTTCAGCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr