ID: 986089793

View in Genome Browser
Species Human (GRCh38)
Location 5:4493103-4493125
Sequence CTTCAGACGCCACCATGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986089789_986089793 29 Left 986089789 5:4493051-4493073 CCTATTTATCTTCCAGTCTCTCT No data
Right 986089793 5:4493103-4493125 CTTCAGACGCCACCATGCAGTGG No data
986089792_986089793 -2 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089793 5:4493103-4493125 CTTCAGACGCCACCATGCAGTGG No data
986089791_986089793 -1 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089793 5:4493103-4493125 CTTCAGACGCCACCATGCAGTGG No data
986089790_986089793 17 Left 986089790 5:4493063-4493085 CCAGTCTCTCTGAAAGCTCCCAG No data
Right 986089793 5:4493103-4493125 CTTCAGACGCCACCATGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986089793 Original CRISPR CTTCAGACGCCACCATGCAG TGG Intergenic
No off target data available for this crispr