ID: 986089798

View in Genome Browser
Species Human (GRCh38)
Location 5:4493121-4493143
Sequence AGTGGACACAGGCAGGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986089792_986089798 16 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089798 5:4493121-4493143 AGTGGACACAGGCAGGCCTCTGG No data
986089791_986089798 17 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089798 5:4493121-4493143 AGTGGACACAGGCAGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986089798 Original CRISPR AGTGGACACAGGCAGGCCTC TGG Intergenic
No off target data available for this crispr