ID: 986089799

View in Genome Browser
Species Human (GRCh38)
Location 5:4493122-4493144
Sequence GTGGACACAGGCAGGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986089792_986089799 17 Left 986089792 5:4493082-4493104 CCAGCTTTGCTGAAGTGAGTGCT No data
Right 986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG No data
986089791_986089799 18 Left 986089791 5:4493081-4493103 CCCAGCTTTGCTGAAGTGAGTGC No data
Right 986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986089799 Original CRISPR GTGGACACAGGCAGGCCTCT GGG Intergenic
No off target data available for this crispr