ID: 986090132

View in Genome Browser
Species Human (GRCh38)
Location 5:4496245-4496267
Sequence CCTCTGTGAATGGTATCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986090132 Original CRISPR CCTCTGTGAATGGTATCAAG AGG Intergenic
901571305 1:10162995-10163017 GCACTGTGAATGGTATAAAGTGG - Intronic
902218068 1:14947181-14947203 CCTGTGTGGATGGTGTCATGAGG + Intronic
903220619 1:21867531-21867553 CCACTTTGAAGGGTATCATGAGG + Intronic
903342646 1:22664118-22664140 CCTCTGAGAATGGGACCAAGGGG - Intergenic
909462511 1:75933705-75933727 ACTCTGTGAATAGTATAAAAAGG - Intergenic
909924388 1:81421947-81421969 CCTCTTTCAATGGTATATAGAGG - Intronic
911233218 1:95382376-95382398 ACTCTGAGAATGGTATCCAAAGG - Intergenic
913945469 1:125158790-125158812 CATCTTTGAATGGAATCAAATGG - Intergenic
917619708 1:176783647-176783669 ACACTGTAAATGGTATCACGAGG - Intronic
920034802 1:203058986-203059008 TCTCAGAGAATGGCATCAAGCGG - Intronic
920775627 1:208934141-208934163 TATCTGTGAATGGTATCTGGAGG - Intergenic
921373401 1:214448761-214448783 TCTCTGTGAATGTTGTCACGTGG - Intronic
922208296 1:223467813-223467835 ACCCTCTGAATGGTATAAAGTGG - Intergenic
924713967 1:246555143-246555165 CCTCTCCTAATGGTATGAAGTGG - Intronic
1063872773 10:10436962-10436984 CCTCAGTGAATGGGATCCTGGGG + Intergenic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1066955731 10:42169338-42169360 CATCATTGAATGGTATCAAAAGG + Intergenic
1067816403 10:49480739-49480761 CCTCAGTGCATGGTATCTGGAGG - Intronic
1071570003 10:86691586-86691608 CCTCTGTAAAGGGAATCTAGGGG + Intronic
1071923471 10:90377567-90377589 CCTTTGAGAATGGGACCAAGAGG + Intergenic
1072214366 10:93275657-93275679 CCTATGTGATTGGCATCAACAGG - Intergenic
1073444394 10:103571921-103571943 CCTCTCTGACTGGTGCCAAGGGG + Intronic
1078147511 11:8731674-8731696 ACTCTGTGTATGGTAAAAAGAGG + Intronic
1079507063 11:21165133-21165155 CCTCTGCGAATGGCACCATGAGG - Intronic
1080920024 11:36699707-36699729 CCTCTTAGAATGGTTACAAGAGG + Intergenic
1089572010 11:119417298-119417320 CCTCTGTGTATGGTAACTACAGG + Intergenic
1090278033 11:125433073-125433095 CCTCTATGTATGGCATCAAAAGG - Exonic
1093258210 12:16899398-16899420 AATCTGTGAATGGTATTAGGAGG + Intergenic
1098053834 12:66482612-66482634 CCTCTGTGAATGGAATTGGGTGG - Intronic
1098469478 12:70826983-70827005 CCACTGTAAATGGCTTCAAGTGG - Intronic
1103164956 12:118762585-118762607 CCTGTATGGATGGTATCAACAGG - Intergenic
1107573225 13:41686002-41686024 TTTTTGTGAATGGTATGAAGTGG + Intronic
1108121427 13:47191370-47191392 CTTCTATGAAAGGTACCAAGAGG - Intergenic
1109261406 13:60149325-60149347 TCTCTGAAAAAGGTATCAAGGGG + Intronic
1112184336 13:97113683-97113705 CATCTGAGCATGGTAACAAGAGG + Intergenic
1112242194 13:97693492-97693514 CCTATGTGAATGTTATAAATAGG - Intergenic
1116607985 14:47027207-47027229 CATATGTGAAGGGTTTCAAGGGG + Intronic
1116941015 14:50790662-50790684 CTTCTGTGTATAGCATCAAGAGG + Intronic
1117554469 14:56870242-56870264 CCTATATGAATCGTATCAATAGG + Intergenic
1126033991 15:44530569-44530591 GCTCTGTGAATGGTAGAAGGTGG + Intergenic
1126581082 15:50243100-50243122 CCTCTGTGAATGATGTCTTGTGG - Intronic
1126754101 15:51907733-51907755 CCTCAGTGAATGCTCTCTAGTGG + Intronic
1128211956 15:65909258-65909280 CCTCTGTGTATAGCATCCAGAGG + Intronic
1128842342 15:70860225-70860247 CCGCTGTGCATGGTATCACAGGG + Intronic
1130941814 15:88516525-88516547 CCTCTTTTAAAGGTATCCAGGGG - Intronic
1133999904 16:10774879-10774901 CCTGTGTGCGTGGTACCAAGAGG - Intronic
1136905804 16:34090597-34090619 CATCAGTGAATGGAATCAAATGG - Intergenic
1136937539 16:34486843-34486865 CATCTTTGAATGGAATCAAATGG + Intergenic
1136944326 16:34628943-34628965 CATCTTTGAATGGAATCAAGTGG - Intergenic
1136946903 16:34663259-34663281 CCTCATTGAATGGAATCAAATGG - Intergenic
1136947319 16:34668715-34668737 CATCATTGAATGGAATCAAGTGG - Intergenic
1136947377 16:34669404-34669426 CATCTTTGAATGGAATCAAATGG - Intergenic
1136950045 16:34705781-34705803 CATCATTGAATGGAATCAAGTGG - Intergenic
1136950079 16:34706267-34706289 CATCATTGAATGGAATCAAGAGG - Intergenic
1136952235 16:34735686-34735708 CATCTTTGAATGGAATCAAATGG - Intergenic
1136962278 16:34861704-34861726 CATCTTTGAATGGAATCAAATGG - Intergenic
1136965608 16:34905895-34905917 CATCTTTGAATGGAATCAAATGG - Intergenic
1136968685 16:34946192-34946214 CATCATTGAATGGAATCAAGTGG - Intergenic
1136969012 16:34950750-34950772 CATCTTTGAATGGAATCAAATGG - Intergenic
1137086727 16:36134305-36134327 CATCAATGAATGGTATCAAATGG - Intergenic
1137090183 16:36179905-36179927 CATCATTGAATGGTATCAAATGG - Intergenic
1137215764 16:46388243-46388265 CATCTTTGAATGGAATCAAATGG + Intergenic
1137216693 16:46400288-46400310 CATCTTTGAATGGAATCAAATGG + Intergenic
1137217809 16:46415413-46415435 CGTCAATGAATGGTATCAAATGG + Intergenic
1141799622 16:86298025-86298047 CCTCTGTCTTTGGTATCAAGGGG + Intergenic
1144533869 17:16067977-16067999 CCTCTGTGATGGGGATCAAACGG + Exonic
1147268310 17:39248237-39248259 CCTCTTTGAAGGGGATTAAGGGG + Intergenic
1152270364 17:79320997-79321019 CCTCTGTGAATGGCTCCAGGTGG - Intronic
926976496 2:18521383-18521405 CCTCTGGGCTTGGAATCAAGAGG + Intergenic
927325884 2:21804521-21804543 CCTCAGGGAAAGGCATCAAGGGG + Intergenic
929248952 2:39731947-39731969 CCTATTGGAATGGTCTCAAGAGG - Intergenic
930284937 2:49415738-49415760 CCTGTGTGAATAGAATTAAGAGG + Intergenic
934189580 2:89775415-89775437 CATCATTGAATGGTATCAAAAGG - Intergenic
937858498 2:126690135-126690157 GCTCTGAGAATGGGTTCAAGTGG - Intronic
938965444 2:136384309-136384331 CCTATGTTAATGGAATGAAGAGG - Intergenic
942850753 2:180482558-180482580 CCTTTGTGAATGGTATTAGGTGG - Intergenic
943718824 2:191181417-191181439 CCTCTGTAAATTGTATCAGCAGG - Intergenic
946215510 2:218180494-218180516 GCTTTGTGACTGGTATGAAGTGG - Intergenic
1168969320 20:1919971-1919993 CCCCTGTGACTGTTATCAGGAGG - Intronic
1170044519 20:12071353-12071375 CCTGTCTGAATGGTGTCAGGCGG + Intergenic
1170326278 20:15157687-15157709 CCTCTATGAATTGTATCACCTGG + Intronic
1180527492 22:16308851-16308873 CATCAATGAATGGTATCAAATGG - Intergenic
1180529804 22:16339824-16339846 CATCATTGAATGGTATCGAGTGG - Intergenic
1203319844 22_KI270737v1_random:45987-46009 CATCATTGAATGGTATCGAGTGG + Intergenic
1203322321 22_KI270737v1_random:78298-78320 CATCAATGAATGGTATCAAATGG + Intergenic
1203326792 22_KI270738v1_random:30782-30804 CATCATTGAATGGAATCAAGTGG + Intergenic
1203328505 22_KI270738v1_random:53769-53791 CATCATTGAATGGTATCAAATGG + Intergenic
1203329096 22_KI270738v1_random:61299-61321 CATCATTGAATGGTATCAAATGG + Intergenic
1202726271 2_KI270716v1_random:1734-1756 CATCTTTGAATGGAATCAAATGG - Intergenic
952757570 3:36885245-36885267 CCTCAGTGAATCGTACCAAGGGG - Intronic
954736668 3:52713213-52713235 CCTCAGTGCATTGTATCAGGAGG - Intronic
955720489 3:61875282-61875304 GCTCCTTGAATGGTATCAACAGG - Intronic
956540402 3:70331784-70331806 CTTCTGTGAATAGAATCAAATGG - Intergenic
956573072 3:70718810-70718832 CCTCTGTGAATAGTTTGAAGGGG - Intergenic
956845813 3:73181573-73181595 TCACTGGGAATGCTATCAAGGGG + Intergenic
957456767 3:80461148-80461170 TATGTGTGAATGGAATCAAGTGG + Intergenic
961021730 3:123513306-123513328 CCTCTGTGATGGTTATCAAATGG - Intronic
968374436 4:27235-27257 GGTCTGTGAGTGGCATCAAGTGG + Intergenic
970950440 4:21749489-21749511 TGTCTGGGAATGGTGTCAAGTGG - Intronic
971853261 4:32010849-32010871 CCTCCTTGAATGGTATCTACAGG + Intergenic
972366319 4:38378393-38378415 CCTGTGTGAATGGTGTCACCTGG - Intergenic
975278711 4:72535113-72535135 GCTCTGAGAATGGTATTAACTGG - Intronic
976340075 4:83937234-83937256 CCTCTGATAAAGGTATCAATAGG - Intergenic
976617531 4:87093615-87093637 TCCCTGTGAATGGTCTGAAGAGG + Intronic
977154328 4:93554343-93554365 CTTCTACGAATAGTATCAAGAGG - Intronic
979293205 4:119000913-119000935 CCCCAGTGAATGGTTTCAGGTGG - Intronic
980300420 4:130983864-130983886 CCTCAGTGATTGGAAGCAAGGGG - Intergenic
985460292 4:190099028-190099050 GGTCTGTGAGTGGCATCAAGTGG - Intergenic
986090132 5:4496245-4496267 CCTCTGTGAATGGTATCAAGAGG + Intergenic
989772472 5:45161082-45161104 CCTCTGGGAATGTTTTTAAGGGG - Intergenic
992321889 5:75621419-75621441 ACTCTGTAAATGGTATCAGGTGG - Intronic
997871827 5:137512814-137512836 CCTCTGTGAATGGTATCAAGAGG - Intronic
997905166 5:137809055-137809077 CATCTTTGACTGGTATCATGAGG + Intergenic
998107139 5:139475856-139475878 ACTCTCTCAATGGTATCAACAGG - Intronic
1000836027 5:166155331-166155353 CCTCTGTGACTGTTAACAAATGG - Intergenic
1000879977 5:166686084-166686106 TCTCAGTGAATTTTATCAAGAGG + Intergenic
1003329215 6:5115824-5115846 ACAATGTGAATGGTATTAAGAGG + Intronic
1007193237 6:40037826-40037848 GCTGTGTGAATGGCATCAATTGG + Intergenic
1007828569 6:44620452-44620474 CCTCCGTGGGTGGTCTCAAGTGG - Intergenic
1009722762 6:67495968-67495990 CCTCTCTGAGTGGTATCATAAGG + Intergenic
1011502967 6:88011206-88011228 CCTGTGTGAACTGTATCAAAAGG - Intergenic
1020438554 7:8192417-8192439 CCTCAGTGCATGGTATCATGTGG + Intronic
1020465641 7:8475539-8475561 CCTCTGTGAATTGCATAAAGTGG + Intronic
1020669585 7:11090227-11090249 TCTCTATGAATCGTAGCAAGAGG + Intronic
1021386585 7:20038445-20038467 CATCAGTGAATGTTATGAAGAGG - Intergenic
1024882258 7:54100908-54100930 CCTCTGTGCATCATATCAAGAGG - Intergenic
1025317455 7:58049798-58049820 CATCTTCGAATGGAATCAAGTGG + Intergenic
1025475416 7:60913998-60914020 CATCTGCGAATGGAATCAAATGG - Intergenic
1025555483 7:62302415-62302437 CATCTTTGAATGGAATCAAATGG + Intergenic
1025566856 7:62446101-62446123 CATCTTTGAATGGATTCAAGTGG - Intergenic
1026761666 7:73131425-73131447 CCTCTGTGAATGCTGTCCACAGG - Intergenic
1027038005 7:74940246-74940268 CCTCTGTGAATGCTGTCCACAGG - Intergenic
1027085556 7:75261228-75261250 CCTCTGTGAATGCTGTCCACAGG + Intergenic
1035909208 8:3547114-3547136 CCTGTGTGAATGGCAGCATGAGG - Intronic
1037105954 8:15108442-15108464 GCTCTGTTAATGAAATCAAGTGG + Intronic
1038486505 8:27939056-27939078 ATTCTGTGTATGGTATAAAGTGG - Intronic
1038806087 8:30793116-30793138 CCTCCGTGCATTGTATCAAGTGG - Intronic
1040525967 8:48225640-48225662 CCTCTGTGAAAGGTCTAAAATGG - Intergenic
1041185368 8:55294571-55294593 CCTCAATGGATGGCATCAAGAGG + Intronic
1042285800 8:67109096-67109118 CCTTTGTTAATGGTCTCAAAAGG + Intronic
1048101678 8:131359007-131359029 CCTCTGCCACTGGTAGCAAGAGG - Intergenic
1048911299 8:139137961-139137983 ACACTGTGGATGGTAGCAAGGGG + Intergenic
1049123930 8:140768440-140768462 CATCTGGGAAAGGTCTCAAGTGG - Intronic
1049130301 8:140833896-140833918 CATCTGTGTATGGGTTCAAGAGG - Intronic
1052842562 9:33305474-33305496 CATCTGAGACTGGTATCAAAGGG - Intronic
1053946769 9:43317737-43317759 CATCAGTGAATGGAATCAAATGG - Intergenic
1053948342 9:43339113-43339135 CCTCATTGAATGGTTTCAAATGG - Intergenic
1056110121 9:83386948-83386970 TCTCAGTGCATGGTATCAGGAGG + Intronic
1057827110 9:98379610-98379632 TCTCTCTTAATGGTATCCAGAGG + Intronic
1060677869 9:125532606-125532628 TTTCTGGGAATGGTAGCAAGTGG - Intronic
1061119435 9:128634215-128634237 CCTCTGGGAAAGGTAGGAAGGGG - Exonic
1062347556 9:136122431-136122453 CTTCTGTGAAGGGTGCCAAGGGG - Intergenic
1203574787 Un_KI270744v1:166916-166938 GGTCTGTGAGTGGCATCAAGTGG - Intergenic
1203589899 Un_KI270747v1:46295-46317 CATCAGTGAATGGAATCAAATGG - Intergenic
1203591075 Un_KI270747v1:61755-61777 CCTCATTGAATGGAATCAATTGG - Intergenic
1203591523 Un_KI270747v1:67312-67334 CCTCATTGAATGGTTTCAAATGG - Intergenic
1186938295 X:14475108-14475130 CCTCTGTGAGTGGTAGAAAGAGG - Intergenic
1188753542 X:33932929-33932951 CCATGGTGAAAGGTATCAAGTGG + Intergenic
1192545505 X:72009393-72009415 CCTGTGTGGATGGCATCAACAGG - Intergenic
1197394108 X:125904993-125905015 CCTCTGAGAAAGTTATAAAGTGG - Intergenic
1198548994 X:137725022-137725044 CCTCTGTAACTGGTGTCCAGTGG + Intergenic
1200087638 X:153616564-153616586 TCTCTGTGTATGGCATCAGGAGG - Intergenic
1201195249 Y:11487793-11487815 CATCATTGAATGGAATCAAGTGG - Intergenic
1201195361 Y:11489368-11489390 CATCATTGAATGGTATCAAAAGG - Intergenic
1201195401 Y:11489887-11489909 CATCATTGAATGGTATCAAAAGG - Intergenic