ID: 986091939

View in Genome Browser
Species Human (GRCh38)
Location 5:4517430-4517452
Sequence AAGCTCCCGTGCTGCCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986091939_986091945 16 Left 986091939 5:4517430-4517452 CCATTCAGGCAGCACGGGAGCTT No data
Right 986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG No data
986091939_986091943 -3 Left 986091939 5:4517430-4517452 CCATTCAGGCAGCACGGGAGCTT No data
Right 986091943 5:4517450-4517472 CTTCTGGAGGTGAAGGTGTCTGG No data
986091939_986091942 -10 Left 986091939 5:4517430-4517452 CCATTCAGGCAGCACGGGAGCTT No data
Right 986091942 5:4517443-4517465 ACGGGAGCTTCTGGAGGTGAAGG No data
986091939_986091946 17 Left 986091939 5:4517430-4517452 CCATTCAGGCAGCACGGGAGCTT No data
Right 986091946 5:4517470-4517492 TGGTGAGGCTGATCAGACATGGG No data
986091939_986091944 2 Left 986091939 5:4517430-4517452 CCATTCAGGCAGCACGGGAGCTT No data
Right 986091944 5:4517455-4517477 GGAGGTGAAGGTGTCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986091939 Original CRISPR AAGCTCCCGTGCTGCCTGAA TGG (reversed) Intergenic
No off target data available for this crispr