ID: 986091945

View in Genome Browser
Species Human (GRCh38)
Location 5:4517469-4517491
Sequence CTGGTGAGGCTGATCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986091939_986091945 16 Left 986091939 5:4517430-4517452 CCATTCAGGCAGCACGGGAGCTT No data
Right 986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986091945 Original CRISPR CTGGTGAGGCTGATCAGACA TGG Intergenic
No off target data available for this crispr