ID: 986093294

View in Genome Browser
Species Human (GRCh38)
Location 5:4532427-4532449
Sequence CCTTCCAAGAGTTCTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986093294_986093300 20 Left 986093294 5:4532427-4532449 CCCTCAGGAGAACTCTTGGAAGG No data
Right 986093300 5:4532470-4532492 TGAGCAGTCAGTCAGCAACCTGG No data
986093294_986093301 21 Left 986093294 5:4532427-4532449 CCCTCAGGAGAACTCTTGGAAGG No data
Right 986093301 5:4532471-4532493 GAGCAGTCAGTCAGCAACCTGGG No data
986093294_986093302 22 Left 986093294 5:4532427-4532449 CCCTCAGGAGAACTCTTGGAAGG No data
Right 986093302 5:4532472-4532494 AGCAGTCAGTCAGCAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986093294 Original CRISPR CCTTCCAAGAGTTCTCCTGA GGG (reversed) Intergenic
No off target data available for this crispr