ID: 986093302

View in Genome Browser
Species Human (GRCh38)
Location 5:4532472-4532494
Sequence AGCAGTCAGTCAGCAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986093297_986093302 -4 Left 986093297 5:4532453-4532475 CCTGTGACCTGCCAGAGTGAGCA No data
Right 986093302 5:4532472-4532494 AGCAGTCAGTCAGCAACCTGGGG No data
986093296_986093302 21 Left 986093296 5:4532428-4532450 CCTCAGGAGAACTCTTGGAAGGA No data
Right 986093302 5:4532472-4532494 AGCAGTCAGTCAGCAACCTGGGG No data
986093294_986093302 22 Left 986093294 5:4532427-4532449 CCCTCAGGAGAACTCTTGGAAGG No data
Right 986093302 5:4532472-4532494 AGCAGTCAGTCAGCAACCTGGGG No data
986093293_986093302 23 Left 986093293 5:4532426-4532448 CCCCTCAGGAGAACTCTTGGAAG No data
Right 986093302 5:4532472-4532494 AGCAGTCAGTCAGCAACCTGGGG No data
986093292_986093302 24 Left 986093292 5:4532425-4532447 CCCCCTCAGGAGAACTCTTGGAA No data
Right 986093302 5:4532472-4532494 AGCAGTCAGTCAGCAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986093302 Original CRISPR AGCAGTCAGTCAGCAACCTG GGG Intergenic
No off target data available for this crispr