ID: 986094859

View in Genome Browser
Species Human (GRCh38)
Location 5:4544512-4544534
Sequence CGGGCTCTACCCGGCATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986094859_986094868 21 Left 986094859 5:4544512-4544534 CCTGGAATGCCGGGTAGAGCCCG No data
Right 986094868 5:4544556-4544578 TCTGCATGCTCAGAAACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986094859 Original CRISPR CGGGCTCTACCCGGCATTCC AGG (reversed) Intergenic
No off target data available for this crispr